|
Valiant Co Ltd
antibody anti β galactosidase Antibody Anti β Galactosidase, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/antibody anti β galactosidase/product/Valiant Co Ltd Average 94 stars, based on 1 article reviews
antibody anti β galactosidase - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
Cusabio
antibody anti-e. coli rpod (rabbit polyclonal) Antibody Anti E. Coli Rpod (Rabbit Polyclonal), supplied by Cusabio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/antibody anti-e. coli rpod (rabbit polyclonal)/product/Cusabio Average 90 stars, based on 1 article reviews
antibody anti-e. coli rpod (rabbit polyclonal) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Cusabio
antibody anti- e. coli rpod (rabbit polyclonal) ![]() Antibody Anti E. Coli Rpod (Rabbit Polyclonal), supplied by Cusabio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/antibody anti- e. coli rpod (rabbit polyclonal)/product/Cusabio Average 90 stars, based on 1 article reviews
antibody anti- e. coli rpod (rabbit polyclonal) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Cusabio
antibody anti-e. coli fima (rabbit polyclonal) ![]() Antibody Anti E. Coli Fima (Rabbit Polyclonal), supplied by Cusabio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/antibody anti-e. coli fima (rabbit polyclonal)/product/Cusabio Average 90 stars, based on 1 article reviews
antibody anti-e. coli fima (rabbit polyclonal) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Bio-Rad
rabbit polyclonal anti e coli antibody ![]() Rabbit Polyclonal Anti E Coli Antibody, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit polyclonal anti e coli antibody/product/Bio-Rad Average 93 stars, based on 1 article reviews
rabbit polyclonal anti e coli antibody - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Boster Bio
rabbit anti mbp ![]() Rabbit Anti Mbp, supplied by Boster Bio, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit anti mbp/product/Boster Bio Average 94 stars, based on 1 article reviews
rabbit anti mbp - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
rabbit polyclonal anti b5 ![]() Rabbit Polyclonal Anti B5, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit polyclonal anti b5/product/Santa Cruz Biotechnology Average 95 stars, based on 1 article reviews
rabbit polyclonal anti b5 - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
Bio-Rad
e coli antibody ![]() E Coli Antibody, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/e coli antibody/product/Bio-Rad Average 93 stars, based on 1 article reviews
e coli antibody - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
rabbit anti ga13 antibody 6f6 b5 santa cruz biotechnology sc 540292 ![]() Rabbit Anti Ga13 Antibody 6f6 B5 Santa Cruz Biotechnology Sc 540292, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit anti ga13 antibody 6f6 b5 santa cruz biotechnology sc 540292/product/Santa Cruz Biotechnology Average 95 stars, based on 1 article reviews
rabbit anti ga13 antibody 6f6 b5 santa cruz biotechnology sc 540292 - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
Journal: eLife
Article Title: Control of pili synthesis and putrescine homeostasis in Escherichia coli
doi: 10.7554/eLife.102439
Figure Lengend Snippet: ( A ) The diagram shows the genes for the FimB and FimE recombinases, the invertible fimS region which contains the promoter for the fim operon, and the fim operon which codes for the proteins of the type 1 pilus. Primer pairs 1–2 and 1–3 detect the fimS region in the phase OFF and ON orientations, respectively. The DNA sizes for phases OFF and ON are 884 and 394, respectively, for wild-type strains of E. coli , such as MG1655. Our lab strain of W3110 has an IS1 element insertion in fimE which increases the size of the amplified DNA fragment. MG1655 was analyzed as a control. Primer 1 is 5’- CCGCGATGCTTTCCTCTATG -3’; primer 2 is 5’- TAATGACGCCCTGAAATTGC -3’; and primer 3 is 5’- TGCTAACTGGAAAGGCGCTG -3’ (shown schematically). ( B ) Deletion of either speB or hns had no effect on fimS orientation. A possible explanation for the loss of pili or PDSM in the speB or hns mutants is locking the fimS switch in phase OFF. However, loss of either speB or hns had no effect on fimS orientation in W3110 (lanes 2–4), and putrescine did not alter fimS orientation of the W3110 ΔspeB mutant (lanes 6 and 7). We conclude that loss of speB in W3110 did not phase-lock fimS in phase OFF. Also note that W3110, which has an insertion in fimE , is not locked in phase ON.
Article Snippet: Antibody ,
Techniques: Amplification, Control, Mutagenesis
Journal: eLife
Article Title: Control of pili synthesis and putrescine homeostasis in Escherichia coli
doi: 10.7554/eLife.102439
Figure Lengend Snippet:
Article Snippet: Antibody ,
Techniques: Transduction, Virus, Sequencing, Ligation, Isolation, Bacteria, Software
Journal: ACS Sensors
Article Title: Capacitive Biosensor for Rapid Detection of Avian (H5N1) Influenza and E. coli in Aerosols
doi: 10.1021/acssensors.4c03087
Figure Lengend Snippet: The performance of the capacitive biosensor for H5N1 and E. coli . We evaluated the sensitivity of the capacitive biosensors for (A) H5N1 and (B) E. coli using serial dilutions of the targets in PBS. Both biosensors showed well-defined linear response ( R 2 ≥ 0.95) to the log concentration of their respective targets. The normalized ΔC% was statistically significant (t-distribution, p < 0.01) indicating that the capacitance of different doses of the targets were statistically differentiated. We also assessed the specificity of (C) H5N1 and (D) E. coli . The signals for both targets, at concentration just above their LoDs (dashed blue line represents LoD signal), were significantly larger than those of interferences even at high concentrations, demonstrating that non-specific pathogens did not affect the capacitive biosensors.
Article Snippet: The H5N1 aptamer with 5′-amino was purchased from Creative Biolabs (Shirley, NY), and the
Techniques: Concentration Assay
Journal: ACS Sensors
Article Title: Capacitive Biosensor for Rapid Detection of Avian (H5N1) Influenza and E. coli in Aerosols
doi: 10.1021/acssensors.4c03087
Figure Lengend Snippet: Quasi-quantification of H5N1 and E. coli aerosols by the capacitive biosensor integrated with the wet cyclone bioaerosol sampler. (A) The flowchart of the process for quasi-quantification and (B) The quasi-quantification to screen H5N1 and E. coli aerosols collected by the wet cyclone air sampler. The capacitive biosensor screened diluted samples, with results displayed as positive (Ο) or negative (X) based on normalized ΔC% relative to the LoDs of each target.
Article Snippet: The H5N1 aptamer with 5′-amino was purchased from Creative Biolabs (Shirley, NY), and the
Techniques: